Happiness is...



Albritton grandkids getting together with your family
(Momma always said there are two kinds of folks in this world - those that are from Alabama, and those that wish they were!)










Albritton boys hanging out with "da boys"
(the four brothers - plus the one nephew!)










Dr. Dan Albritton and the Nobel Peace Prize winning the Nobel Peace Prize
(My Uncle Dee was a scientist with the Intergovernmental Panel on Climate Change (IPCC) - an organization that shared half of the Nobel Peace Prize with Al Gore in 2007)










Deer at the Entrance to Todaiji in Nara, Japan making new friends
(while working as the UHM Faculty Resident Director for the summer Japanese language program in Kobe, Japan, i had a chance to check out the temples at Nara. check out Leeward CC's Study Abroad Program!)










On the Kalalau Trail going for a hike
(i had a close call on the Kalalau Trail)










Getting hugged by a Hawaiian Monk Seal off Molokini Island a warm monk seal
(this guy gave me a hug one day at Molokini)










Caught my first wave off Kujuukuri, Chiba Prefecture, Japan going surfing in Japan
(if you have not done the JET Program yet, you need to check it out)










Oberlin College graduation graduating from college
(this is Oberlin College - back in the day)










The four Albritton brothers at Moundville, Alabama wearing a Davey Crockett coon-skin hat
(these hats were very fashionable when i was growing up in Alabama. i am on the left)










The five Miller brothers in the late 1800's talking about old times
(these are the Miller brothers in the late 1800's. my great-grandfather, Joseph Neely Miller, who Grandma said "ran in the war", is on far right)










Albritton family creast a long time ago in a galaxy far, far away....
(we can trace our ancestors back to John Knox and further back to Robert II, King of Scotland.)










Journey of my Y-chromosome going on a DNA journey
(this is the path that my ancestors took, according to the DNA sequencing on my Y-chromosome and my mitochondrial DNA that i did for The Genograpic Project. for example, this sequence of my mitochondrial DNA has two transitional mutations, which subsitutes a C for a T and vice-versa:
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGAT
TTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTAT
GTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTA
CCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCAC
ATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAA
CCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTC
ACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACAT
AGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAAT
CCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCT
TGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCT
ACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGT
GAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAGCC
TAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG
)
Journey of my Mitochondrial DNA











Charlie Brown and Snoopy hugging Happiness Is a Warm Puppy by Charles M. Schulz

Happiness is. . .
a thumb and a blanket
an umbrella and a new raincoat
a pile of leaves
a warm puppy
an "A" on your spelling test
finding someone you like at the front door
three friends in a sandbox ... with no fighting
sleeping in your own bed
a chain of paper clips
getting together with your friends
a smooth sidewalk
finally getting the sliver out
a climbing tree
lots of candles
being able to reach the doorknob
knowing all the answers
a night light
some black, orange, yellow, white and pink jelly beans, but no green ones
the hiccups ... after they've gone away
a good old fashioned game of hide and seek
a fuzzy sweater
a bread and butter sandwich folded over
knowing how to tie your own shoes
walking in the grass in your bare feet
eighteen different colors
a piece of fudge caught on the first bounce
finding the little piece with the pink edge and part of the sky and the top of the sailboat
finding out you're not so dumb after all
thirty-five cents for the movie, fifteen cents for popcorn and a nickel for a candy bar
one thing to one person and another thing to another person


Click to validate the HTML code

Click to validate the CSS code